Indications of a bright future through science
April 26, 2012
Looking forward Cell Bio- mitochondrial DNA linked to inflammation?
April 26, 2012
general Bio610, Bio620, general Leave a comment
As we are heading from molecular to cell biology I am starting to collect topics that may be of your interest. I just saw this today, published online in Nature (note: NU Library has the paper subscription, so for online first articles you need to wait until it comes out as a print reference, and then they are available). Seems pretty interesting, and is one more addition to the autophagy issue (cells degrade their components for a variety of reasons, among them pure recycling of defective stuff or starvation), which seems to be extremely important for cellular health. Not to mention the mitochondria issue- there seems to be some delicate interplay between mitochondria’s ability to generate ATP and the cell’s needs and abilities to use it. For now, copying the abstract and one picture.
Mitochondrial DNA that escapes from autophagy causes inflammation and heart failure
Takafumi Oka et al
Nature (2012) doi:10.1038/nature10992
Published online 25 April 2012
Effect of heart overload in normal and DNAse-knockout mice- observe the change of size of the heart!
Heart failure is a leading cause of morbidity and mortality in industrialized countries. Although infection with microorganisms is not involved in the development of heart failure in most cases, inflammation has been implicated in the pathogenesis of heart failure1. However, the mechanisms responsible for initiating and integrating inflammatory responses within the heart remain poorly defined. Mitochondria are evolutionary endosymbionts derived from bacteria and contain DNA similar to bacterial DNA2, 3, 4. Mitochondria damaged by external haemodynamic stress are degraded by the autophagy/lysosome system in cardiomyocytes5. Here we show that mitochondrial DNA that escapes from autophagy cell-autonomously leads to Toll-like receptor (TLR) 9-mediated inflammatory responses in cardiomyocytes and is capable of inducing myocarditis and dilated cardiomyopathy. Cardiac-specific deletion of lysosomal deoxyribonuclease (DNase) II showed no cardiac phenotypes under baseline conditions, but increased mortality and caused severe myocarditis and dilated cardiomyopathy 10 days after treatment with pressure overload. Early in the pathogenesis, DNase II-deficient hearts showed infiltration of inflammatory cells and increased messenger RNA expression of inflammatory cytokines, with accumulation of mitochondrial DNA deposits in autolysosomes in the myocardium. Administration of inhibitory oligodeoxynucleotides against TLR9, which is known to be activated by bacterial DNA6, or ablation of Tlr9 attenuated the development of cardiomyopathy in DNase II-deficient mice. Furthermore, Tlr9 ablation improved pressure overload-induced cardiac dysfunction and inflammation even in mice with wild-type Dnase2a alleles. These data provide new perspectives on the mechanism of genesis of chronic inflammation in failing hearts.
BioTechniques – Last Days of Exome Sequencing
April 25, 2012
general general Leave a comment
This is really good and pertinent to the class- it compares the pros/cons and costs of exome versus whole genome sequencing.
Cloning assignment
April 23, 2012
Uncategorized Bio610, practical assignments, Uncategorized Leave a comment
Here is an example of the submission for the cloning assignment.
I keep working with my old friend human TNF.
Restriction mapping of TNF
This is the restriction map obtained using Nebcutter. I can submit the figure, or alternatively I can save the list as a .txt file by using the List function (only 1 cutters). However I will spare you the long list, as none of those sites is useful for me.
The vector I am interested in is the p-CLIP vector. This is a vector that has a CLIP tag, and one can insert the gene of the protein of interest either before or after the tag, so that means that one can have the protein tagged either at the N or at the C terminal. This can be useful for many reasons, but in the case of TNF, as it is cleaved closer to the N-terminus from the proform to the soluble form, either tagging could give information fo what happens to either product.
Here is the official description:
pCLIPf Vector is a mammalian expression plasmid intended for the cloning and stable or transient expression of CLIP-tag® protein fusions in mammalian cells. This plasmid encodes CLIPf, a CLIP-tag protein, which is expressed under control of the CMV promoter. The expression vector has an IRES (internal ribosome entry site) and a neomycin resistance gene downstream of the CLIPf for the efficient selection of stable transfectants. pCLIPf Vector contains two multiple cloning sites to allow cloning of the fusion partner as a fusion to the N- or C-terminus of the CLIPf.
The CLIP-tag is a novel tool for protein research, allowing the specific, covalent attachment of virtually any molecule to a protein of interest. The CLIP-tag is a small polypeptide based on human O6-alkylguanine-DNA-alkyltransferase (hAGT). CLIP-tag substrates are derivatives of benzyl cytosine (BC). In the labeling reaction, the substituted benzyl group of the substrate is covalently attached to the reactive cysteine of CLIP-tag forming a stable thioether link.
pCLIPf contains an improved version of CLIP-tag, termed CLIPf. CLIPf displays faster kinetics in in vitro labeling and fast, specific and efficient labeling in live and fixed cell applications, thereby rendering it a desired research tool for analysis of protein dynamics.
And this is the map:
p-CLIP vector
I am interested in following the cleaved soluble TNF, so I will use MCS-1 to insert the sequence (that way the CLIP tag will be on the C-terminus). Here are the enzymes involved:
Restriction sites of the MCS1 of the pCLIP vector
I run the Primer Blast and I get several recommendations for primers. At the first try it will give me a pair within the sequence, so I have to set a range of 140-200 and 890-940 for the forward and the reverse primers, respectively.The primers provided by the program were:
Forward primer 1 CTCCACCCTCTCTCCCCTGGA 21
Template 140 ………………… 160
Reverse primer 1 ATTGGGGCAGGGGAGGCGTT 20
Template 916 ……………….. 897
(Practical observation: restriction enzymes are expensive, so most labs will have a modest collection of the “workhorses,” which are such as EcoRI, BamH1, Xho1, HindIII, and some more. So often your decision as to which enzyme to buy will depend largely of which are already in the lab freezer. EcoRI was a no-brainer for one of the sites, and I chose EcoRV because it was a short sequence and easy to insert.)
PCR primers: Forward: GATATCTCCACCCTCTCTCCCCTGGA (with EcoRV site in bold)
Reverse: GAATTCATTGGGGCAGGGGAGGCGTT (with EcoRI site in bold).
Note: in real life I would have probably added some more bases just in case before the restriction sequence, and would have run some simulation runs in a software to optimize the primers’ parameters regarding length and added sequences.
Searching for information
April 17, 2012
general Bio610, general, Science Leave a comment
So you have an idea of what you want to study-explore-research. You think that it passes the “So what” test. Now you have to look for information.
In search for the apple of knowledge
What you do?
I am sure most of you (and even me!) will google up the word. Very probably you (and I) will use Wikipedia as a starting point. Nothing wrong with it…as long as it is the starting point.
Here are some more strategies:
- database search: there are plenty of databases, one of the most used being Pubmed (Entrez) but there is Library of Congress and many others. If in doubt talk to the librarians. They will help you not only to choose databases, but also to establish searches based on keywords or other criteria.
- Crawling the story of the paper: most topics will have a few labs that are known and prestigious regarding the topic, and you want to identify them quickly. Then you start the detective work backwards and laterally. Backwards means going backward in time with the papers. Chances are that the description of the methodology or model used in all papers is tucked away in a paper 20 years ago. Laterally means looking for other people involved in this research via collaborations, sharing resources etc. Even if the sharing is purely methodological, it is always worth to know what people do with the same system using a certain model.
- Be aware of controversies and rivalries. This is harder to spot if you are outside the field, but look for any statement regarding differing opinions or experiments that cannot be repeated. You may find a completely different view of the topic.
- High impact journals are usually the most respected source of knowledge. However do not underestimate the information coming from other sources. Besides controversies, there may be sheer practical reasons for scientists not to travel to a certain prestigious conference or publishing in a certain paper, such as…money.
- 21st century tools: explore the social media. See if any of the main scientists related to the topic has a blog or is on Twitter. If so, be sure to follow them and make intelligent comments on their postings. Who knows, maybe they will notice you and share some of their nuggets of wisdom (or inside information).
- San Diego is a great place for biosciences. Every week there is probably a world-renown expert giving a seminar somewhere in La Jolla. Many of them are open to the public, some require registration but not fees, and some may require something to pay. You can have the chance to actually see and listen to the main expert in your topic, how cool is that! Ok how do you know about the seminars? There are some aggregator sites such as Biocom, and San Diego Biotech network, the latter actually has a long list of other networking groups in the region. You may need to visit your favorite institutions’ websites for seminar schedules.
- San Diego is also a great conference place. Many big name events happen in the Convention Center. And many events require volunteers. Or offer discounted registration for students. So look up the conference schedules and see if you can volunteer to any of those! Once inside, you can probably use some of your time to wander around and maybe corral your favorite scientist.
- AAAS is a great organization, and their conferences are usually very affordable for students.
While you can obviously find lots of information from paper articles, there may be changes happening in relationship to your topic. Exciting preliminary results, several results heralding a paradigm change, new emerging technologies…that information is priceless to have a good sense of what is going on in the filed. Therefore I encourage you to think out of the box regarding the search for knowledge. The closer you are to the source, the more recent and probably relevant the information.
Good luck in your quest!
My favorite orthologs
April 14, 2012
general Bio610, general, practical assignments, TNF Leave a comment
Human TNF
This human TNF gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, and cancer. Knockout studies in mice also suggested the neuroprotective function of this cytokine.
For a recent review of the human TNF superfamily see Aggarwal et al, 2012.
TNF superfamily members include the cytokines: TNF (TNF-alpha), LT (lymphotoxin-alpha, TNF-beta), CD40 ligand, Apo2L (TRAIL), Fas ligand, and osteoprotegerin (OPG) ligand. These proteins generally have an intracellular N-terminal domain, a short transmembrane segment, an extracellular stalk, and a globular TNF-like extracellular domain of about 150 residues.
TNF superfamily structure
They initiate apoptosis by binding to related receptors, some of which have intracellular death domains. They generally form homo- or hetero- trimeric complexes.TNF cytokines bind one elongated receptor molecule along each of three clefts formed by neighboring monomers of the trimer with ligand trimerization a requiste for receptor binding.
Orthologs
TNF is highly conserved among mammals, with over 90% homology in primates. It is highly homologous to the murine (mus musculus TNF, accession number NP_038721.1), showing a 79% homology.
An initial search for orthologs did not bring many hits. I kept combing the literature and found a reference to a molecule called Eiger in Drosophila and another reference to a TNF-like molecule in the sea urchin. Then I kept mining and found references to TNF in fishes and amphibians.
<I have to make a philosophical pause here. Scientists are usually very specialized in their fields, a necessary requirement. Specialization comes often with complete blindness to other disciplines or areas. So I confess that during all my years of researching TNF I did not look further than the “TNF is highly conserved in vertebrates” mantra, so focused I was on human TNF and human diseases associated to TNF. It was only when writing my thesis that I ventured into reading more in detail about other organisms, as many mechanistical details of TNF pathways came from comparing immune pathways in different organisms, particularly in Drosophila. So I am glad to say that although I chose TNF as an example of this assignment because I thought it would be slam-dunk to prepare, I have actually learned a lot of cool information that was new for me.>
Finally I have arrived to this article by Wiens and Glenney, 2011, which I just ordered through ScienceDirect, so I do not have access to it…but here is what the abstract says:
The tumor necrosis factor superfamily (TNFSF) and the TNF receptor superfamily (TNFRSF) have an ancient evolutionary origin that can be traced back to single copy genes within Arthropods. In humans, 18 TNFSF and 29 TNFRSF genes have been identified. Evolutionary models account for the increase in gene number primarily through multiple whole genome duplication events as well as by lineage and/or species-specific tandem duplication and translocation. The identification and functional analyses of teleost ligands and receptors provide insight into the critical transition between invertebrates and higher vertebrates. Bioinformatic analyses of fish genomes and EST datasets identify 14 distinct ligand groups, some of which are novel to teleosts, while to date, only limited numbers of receptors have been characterized in fish. The most studied ligand is TNF of which teleost species possess between 1 and 3 copies as well as a receptor similar to TNFR1. Functional studies using zebrafish indicate a conserved role of this ligand–receptor system in the regulation of cell survival and resistance to infectious disease.
I need to show this- a comparison of the vertebrate and the amphibious immune system, copied from Huang’s article. See TNF to the left of both.
Comparison between amphibian and vertebrate immune systems (from Huang et al, 2008).
Well, I have to stop here…but I hope you see my point of the importance of narrowing down your topic, as it always expands as you start digging!
I hope you undertand a bit the point of the past 2 assignments: we are looking for a protein related to a function. The structure of the protein is often related to its function- and we have had the chance to see different proteins, from transcription factors to toxins, enzymes, and hormones. Take a pause and look at the function- how specific it is? That will relate directly to how conserved that gene is going to be- you would expect a protein involved in some essential and widespread metabolic function to go back earlier in phylogeny compared to a protein associated to a more specific function. In my particular example, TNF is part of the immune response, so it is mainly described for vertebrates particularly mammals. But as you see from the abstract above, you see the beginnings going back to Arthropods.
Conserved features
Trimer interface, which is a conserved ring of hydrophobic residues; aids in self-assembly of monomers.
Receptor binding site. TNF ligands share a common structural motif, the TNF homology domain (THD), which binds to cysteine-rich domains (CRDs) of TNF receptors. CRDs are composed of structural modules, whose variation in number and type confers heterogeneity upon the family. Protein folds reminiscent of the THD and CRD are also found in other protein families, raising the possibility that the mode of interaction between TNF and TNF receptors might be conserved in other contexts
My favorite protein assignment: tumor necrosis factor (TNF)
April 14, 2012
Uncategorized Bio610, TNF, Uncategorized Leave a comment
This is an example of how to organize the protein assignment page.
Human Tumor necrosis factor
Tumor necrosis factor (also called cachectin, TNF-alpha, or TNFSF2) is a cytokine originally described as a mediator of septic shock but it is currently considered a master regulator of cell death, survival, and organogenesis.
Tumor necrosis factor (TNF; also named TNFa) is a type II transmembrane protein with an intracellular amino terminus. It has signalling potential both as a 26 kd membrane-integrated protein and as a soluble cytokine released after cleavage by the protease TACE; its soluble form is a trimer of 17 kDa components. There are two TNF receptors: TNFR1, which is found on most cells in the body, and TNFR2, which is primarily expressed on cells of hematopoietic origin. TNFR1 is activated by both TNF forms, while TNFR2 primarily binds transmembrane TNF. TNF receptors are also shed and act as soluble TNF-binding proteins, competing with cell surface receptors for free ligand and thus inhibiting TNF action (Locksley et al, 2001, Hehlgans et al, 2005).
The signaling pathways mediated by the two receptors are slightly divergent. TNFR1 is considered to mediate more systemic effects. The result of its activation can lead to cell proliferation or death depending on context. In contrast to TNFR1, TNFR2 lacks a death domain. Its biological role is still not fully understood, although recent evidence suggests that it can modulate the actions of TNFR1 on immune and endothelial cells. Transmembrane TNF can function as both ligand and receptor: soluble TNF receptors can bind to the cytokine on the cell surface and generate reverse signaling (Balkwill, 2009).
TNF Sequence (from PDB)
Gene
The human TNF gene (TNFA) was cloned in 1985 (Lloyd et al, 1985). It maps to chromosome 6p21.3 (short arm), close or within the MHC (Major Histocompatibility Complex) region. It spans about 3 kb and contains 4 exons. The 3′ UTR of TNF alpha contains an AU-rich element (ARE), providing a means of post-transcriptional control.
Protein
The protein is translated as a 233 amino acid (26kD) type II transmembrane protein, which is further cleaved by the protease TACE (ADAM 17). Both forms exist as trimers. The 17 kd TNF protomers (185-amino acid-long) are composed of two antiparallel β-pleated sheets with antiparallel β-strands, forming a ‘jelly roll’ β-structure, typical for the TNF family.
Here are two renderings of TNF from the PDB site. However, for the 3D effects you may want to visit the Jmol view.
PDB rendering of TNF
Another rendering of TNF
Protein Databank Reference (PDB): 1TNF
Uniprot entry: P01375
NCBI RefSeq : NP000585.2
How to embed videos and the kitchen sink
April 14, 2012
general Bio610, Blogs, general Leave a comment
Let me start saying that I am the typical person who does not read instructions. Mea culpa. It has brought many issues and hiccups for me, on the other hand I am usually pretty quick in figuring out the way things work…although it may not be the BEST way.
So, I recommend that you do not follow my example and read or watch the instruction materials of everything you do, particularly this blog. That said, here is some insight that you may already know, but just in case…
I see that most of you have inserted pictures, which is not that difficult as you use the little camera icon to the right of Upload/Insert on the top. Videos may be a bit trickier.
Let’s say you are in Youtube. Click on the Share button and then click again on Embed. A code will come up, which is already highlighted- so you can copy directly using the keyboard shortcuts Ctrl-C (win) or Command-C (Mac).
It looks something like this:
< iframe width=”560″ height=”315″ src=”http://www.youtube.com/embed/bl8Vucquc7g” frameborder=”0″ allowfullscreen></iframe > NOTE I had to put a space between the first/last bracket and the rest of the text otherwise it would embed right away
How to find the embed code in Youtube
Now paste the code into your post. Seems like WordPress will embed your code right away. My experience with other sites is that you have to embed the HTML code into the HTML window upper right tab by Visual). So use the Preview button to the right of the editing panel and check. If the thumbnail comes out, fine. Otherwise you may want to click on the HTML tab to get into the coding window and paste the code there. Once you get back to Visual you will see a thumbnail outline.
Usually that is all what you need. If by any chance you are embedding something that comes out too big, you may go back to HTML and look for the words height and Width, and the numbers after them. The rule is that you change them both the same way (half them, for example).
Voila, ready to post! This particular video is about transfections, a quickie illustration of a procedure we will be talking next week.
Re kitchen sink: I just realized that clicking on the rightmost little icon of your editing panel (Show/hide kitchen sink) opens a whole range of options I have been missing, such as styles, text colors, and other goodies.
The procedure if basically the same for Blogger- copying the Embed code and pasting it into the HTML window.
Do you have any other insight about WordPress or blogger? Please share 🙂
Looking forward seeing your protein postings!
Quick tutorial for Chi square in Excel.
April 13, 2012
general Bio610, general, Statistics Leave a comment
This is a tutorial for example 22.1, p.468 of Zar. Sorry, my cat is meowing in the background.
http://www.kaltura.com/index.php/kwidget/wid/_408291/uiconf_id/5428202/entry_id/1_ut5tqk58
So what?
April 13, 2012
Uncategorized Bio610, Science, Uncategorized Leave a comment
Next week my students are presenting the outline of their research project. Most of them have an idea of project, some rather focused, others less, but the point in this course (Molecular Biology) is to address the molecular level of their topic. As I write the instructions of the outline, the questions that reverberates in my mind is “so what?”
I remember that question clearly from my grad student and especially post doc years. It was something along the lines: your presentation should say “what,then what, and so what.” Meaning, you will present the problem-issue-background of your plan, then you will explain what is that you will do about it, and what is its significance. The “so what” part was indeed the most critical: what is the impact, usefulness, advantage, or importance of your plan?
Here is an expanded version of this advice, directed to research proposals.
While it is always better to have a narrowly focused research topic, being too broad right now is not a big problem. There will be time to develop a focus on something, and the different courses give students the chance to look at their topic from different angles. For this course it is the molecular angle, which is not difficult once you correlate a characteristic with a function, which immediately connects with function.
Of course there is a need to keep our eyes on the big picture too. Because otherwise we lose the “so what” test. The study of a particular function of a particular molecule is not done just because it is fun. There should be a rationale for it. Sometimes the rationale is an immediate application, which is nice. But sometimes it is about clarifying an issue that is controversial, or explaining a phenomenon that is unclear. But remember, to convince your audience you need to pass the test. And while today your audience is that of your classmates, next time it may be a future supervisor or a hiring committee. So it is good to be prepared!
And here is a video I was going to show during my research presentation, but ran out of time. It is about a Ph.D. thesis, but I guess it is not that different for Masters. Enjoy!
barralopolis 